Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103294
Name   oriT_pESBL171 in_silico
Organism   Escherichia coli strain E. coli UB-ESBL171
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MT230156 (2497..2556 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pESBL171
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3737 GenBank   NZ_MT230156
Plasmid name   pESBL171 Incompatibility group   ColRNAI
Plasmid size   5554 bp Coordinate of oriT [Strand]   2497..2556 [+]
Host baterium   Escherichia coli strain E. coli UB-ESBL171

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -