Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103276 |
| Name | oriT_p16EC-9K  |
| Organism | Escherichia coli strain 16EC |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MN381965 (3179..3236 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_p16EC-9K
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3719 | GenBank | NZ_MN381965 |
| Plasmid name | p16EC-9K | Incompatibility group | Col440I |
| Plasmid size | 9228 bp | Coordinate of oriT [Strand] | 3179..3236 [+] |
| Host baterium | Escherichia coli strain 16EC |
Cargo genes
| Drug resistance gene | tet(X4) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |