Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103272 |
| Name | oriT_pSS1129  |
| Organism | Escherichia coli strain Mach1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MN057686 (6771..6882 [-], 112 nt) |
| oriT length | 112 nt |
| IRs (inverted repeats) | 72..78, 81..87 (CACCCGC..GCGGGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 112 nt
>oriT_pSS1129
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3715 | GenBank | NZ_MN057686 |
| Plasmid name | pSS1129 | Incompatibility group | ColRNAI |
| Plasmid size | 9690 bp | Coordinate of oriT [Strand] | 6771..6882 [-] |
| Host baterium | Escherichia coli strain Mach1 |
Cargo genes
| Drug resistance gene | blaTEM-1A, aac(3)-Ia |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |