Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103260 |
| Name | oriT1_pBuzz  |
| Organism | Escherichia coli strain 838B |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MF156267 ( 1080..1152 [+], 73 nt) |
| oriT length | 73 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 73 nt
>oriT1_pBuzz
GTCGGGGCGAAGCCCTGACCAGGTGGGGAATGTCTGAGCGAGCGTGCGCGGTCCGACATTCCCACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGTGGGGAATGTCTGAGCGAGCGTGCGCGGTCCGACATTCCCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3703 | GenBank | NZ_MF156267 |
| Plasmid name | pBuzz | Incompatibility group | ColpVC |
| Plasmid size | 1982 bp | Coordinate of oriT [Strand] | 1415..1487 [-]; 1080..1152 [+] |
| Host baterium | Escherichia coli strain 838B |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |