Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103249 |
| Name | oriT_GW-Imi-1b1|unnamed1  |
| Organism | Citrobacter braakii strain GW-Imi-1b1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP115724 (139927..140030 [+], 104 nt) |
| oriT length | 104 nt |
| IRs (inverted repeats) | 55..60, 73..78 (TGGAAT..ATTCCA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 104 nt
>oriT_GW-Imi-1b1|unnamed1
ATTTGACAAATTCCAAAGATGGGGTAGCCTAGTAACAGGATTAGATTCCAATATTGGAATAATCAGCTTTAAATTCCAGATAGATAGCTATGTGGATAGGAATT
ATTTGACAAATTCCAAAGATGGGGTAGCCTAGTAACAGGATTAGATTCCAATATTGGAATAATCAGCTTTAAATTCCAGATAGATAGCTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3692 | GenBank | NZ_CP115724 |
| Plasmid name | GW-Imi-1b1|unnamed1 | Incompatibility group | IncA/C2 |
| Plasmid size | 140871 bp | Coordinate of oriT [Strand] | 139927..140030 [+] |
| Host baterium | Citrobacter braakii strain GW-Imi-1b1 |
Cargo genes
| Drug resistance gene | formA |
| Virulence gene | - |
| Metal resistance gene | arsC, arsB, arsA, arsD, arsR, merR, merT, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |