Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103229
Name   oriT_N57952F_qnrB19 in_silico
Organism   Salmonella enterica subsp. enterica serovar Anatum strain CVM N57952F
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_KY991369 (2163..2220 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_N57952F_qnrB19
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3672 GenBank   NZ_KY991369
Plasmid name   N57952F_qnrB19 Incompatibility group   Col440I
Plasmid size   3071 bp Coordinate of oriT [Strand]   2163..2220 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Anatum strain CVM N57952F

Cargo genes


Drug resistance gene   qnrB19
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -