Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103226 |
| Name | oriT_C6656|unnamed  |
| Organism | Klebsiella pneumoniae strain C6656 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_ON111451 (75203..75326 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 101..106, 119..124 (TTTAAT..ATTAAA) 91..99, 113..121 (AATAATGTA..TACATTATT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_C6656|unnamed
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3669 | GenBank | NZ_ON111451 |
| Plasmid name | C6656|unnamed | Incompatibility group | IncR |
| Plasmid size | 124154 bp | Coordinate of oriT [Strand] | 75203..75326 [+] |
| Host baterium | Klebsiella pneumoniae strain C6656 |
Cargo genes
| Drug resistance gene | blaKPC-2, blaSHV-12, blaCTX-M-65, fosA3, rmtB |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |