Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103196
Name   oriT_2020CK-00200|unnamed6 in_silico
Organism   Klebsiella oxytoca strain 2020CK-00200
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP115685 (5908..5967 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_2020CK-00200|unnamed6
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3639 GenBank   NZ_CP115685
Plasmid name   2020CK-00200|unnamed6 Incompatibility group   Col440I
Plasmid size   12166 bp Coordinate of oriT [Strand]   5908..5967 [-]
Host baterium   Klebsiella oxytoca strain 2020CK-00200

Cargo genes


Drug resistance gene   blaKPC-3
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -