Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103159
Name   oriT_FWSEC0269|unnamed1 in_silico
Organism   Escherichia coli strain FWSEC0269
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RRJL01000063 (516..574 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_FWSEC0269|unnamed1
GGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3602 GenBank   NZ_RRJL01000063
Plasmid name   FWSEC0269|unnamed1 Incompatibility group   Col
Plasmid size   1780 bp Coordinate of oriT [Strand]   516..574 [-]
Host baterium   Escherichia coli strain FWSEC0269

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -