Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103119 |
| Name | oriT_pG06-VIM-1  |
| Organism | Klebsiella pneumoniae strain AO-15200 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_KU665641 (33062..33161 [-], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 78..83, 90..95 (AAAAAA..TTTTTT) 78..83, 89..94 (AAAAAA..TTTTTT) 32..39, 42..49 (AGCGTGAT..ATCACGCT) 18..24, 36..42 (TAAATCA..TGATTTA) |
| Location of nic site | 60..61 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_pG06-VIM-1
ATTTTGTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
ATTTTGTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3562 | GenBank | NZ_KU665641 |
| Plasmid name | pG06-VIM-1 | Incompatibility group | IncR |
| Plasmid size | 53618 bp | Coordinate of oriT [Strand] | 33062..33161 [-] |
| Host baterium | Klebsiella pneumoniae strain AO-15200 |
Cargo genes
| Drug resistance gene | mph(A), aph(3'')-Ib, aph(6)-Id, aph(3')-Ia, dfrA12, aadA2, qacE, sul1, ant(3'')-Ia, dfrA1, aac(6')-Il, blaVIM-1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |