Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103107
Name   oriT_pNUC in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain ST1004
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_KU852461 (3138..3297 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pNUC
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3550 GenBank   NZ_KU852461
Plasmid name   pNUC Incompatibility group   IncQ1
Plasmid size   11069 bp Coordinate of oriT [Strand]   3138..3297 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain ST1004

Cargo genes


Drug resistance gene   tet(A), sul2, aph(3'')-Ib, aph(6)-Id
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -