Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103094 |
| Name | oriT_pM411  |
| Organism | Lactiplantibacillus plantarum strain 1-3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_KU707950 (1710..1745 [-], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pM411
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3537 | GenBank | NZ_KU707950 |
| Plasmid name | pM411 | Incompatibility group | - |
| Plasmid size | 2303 bp | Coordinate of oriT [Strand] | 1710..1745 [-] |
| Host baterium | Lactiplantibacillus plantarum strain 1-3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |