Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103069 |
| Name | oriT_pEC16II  |
| Organism | Escherichia coli |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_KU932034 (5560..5620 [-], 61 nt) |
| oriT length | 61 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 61 nt
>oriT_pEC16II
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGGATAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3512 | GenBank | NZ_KU932034 |
| Plasmid name | pEC16II | Incompatibility group | ColRNAI |
| Plasmid size | 7939 bp | Coordinate of oriT [Strand] | 5560..5620 [-] |
| Host baterium | Escherichia coli |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |