Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103019 |
| Name | oriT_pFP119  |
| Organism | Escherichia coli strain FP119 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_KX452393 (2799..2856 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pFP119
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3462 | GenBank | NZ_KX452393 |
| Plasmid name | pFP119 | Incompatibility group | Col440I |
| Plasmid size | 2989 bp | Coordinate of oriT [Strand] | 2799..2856 [+] |
| Host baterium | Escherichia coli strain FP119 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |