Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103016 |
| Name | oriT_pNDM1_SZ1  |
| Organism | Enterobacter cloacae strain SZECL1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_KU302801 (129628..129732 [+], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | 56..61, 74..79 (TGGAAT..ATTCCA) 46..51, 56..61 (ATTCCA..TGGAAT) 1..6, 8..13 (AATTTG..CAAATT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 105 nt
>oriT_pNDM1_SZ1
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3459 | GenBank | NZ_KU302801 |
| Plasmid name | pNDM1_SZ1 | Incompatibility group | IncA/C2 |
| Plasmid size | 130573 bp | Coordinate of oriT [Strand] | 129628..129732 [+] |
| Host baterium | Enterobacter cloacae strain SZECL1 |
Cargo genes
| Drug resistance gene | aph(3'')-Ib, aph(6)-Id, dfrA12, aadA2, qacE, sul1, blaNDM-1, armA, msr(E), mph(E), sul2 |
| Virulence gene | htpB |
| Metal resistance gene | merE, merD, merA, merC, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |