Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 103012 |
Name | oriT_pEc17183 |
Organism | Escherichia coli strain Ec17183 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_KX257264 (795..851 [-], 57 nt) |
oriT length | 57 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pEc17183
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 3455 | GenBank | NZ_KX257264 |
Plasmid name | pEc17183 | Incompatibility group | Col440I |
Plasmid size | 2702 bp | Coordinate of oriT [Strand] | 795..851 [-] |
Host baterium | Escherichia coli strain Ec17183 |
Cargo genes
Drug resistance gene | qnrB19 |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |