Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102990 |
| Name | oriT_pRIVM4293  |
| Organism | Staphylococcus aureus strain RIVM4293 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP013628 (1538..1578 [-], 41 nt) |
| oriT length | 41 nt |
| IRs (inverted repeats) | 14..22, 29..37 (TAAAGTATA..TATACTTTA) 2..8, 13..19 (ACTTTAT..ATAAAGT) |
| Location of nic site | 27..28 |
| Conserved sequence flanking the nic site |
GTGTGTTATA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 41 nt
>oriT_pRIVM4293
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTACATG
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3433 | GenBank | NZ_CP013628 |
| Plasmid name | pRIVM4293 | Incompatibility group | - |
| Plasmid size | 6686 bp | Coordinate of oriT [Strand] | 1538..1578 [-] |
| Host baterium | Staphylococcus aureus strain RIVM4293 |
Cargo genes
| Drug resistance gene | dfrK, tet(L), aadD |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |