Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102972 |
| Name | oriT_pF5  |
| Organism | Klebsiella pneumoniae subsp. pneumoniae strain F5 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP016403 (53416..53465 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pF5
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3415 | GenBank | NZ_CP016403 |
| Plasmid name | pF5 | Incompatibility group | IncFII |
| Plasmid size | 105125 bp | Coordinate of oriT [Strand] | 53416..53465 [+] |
| Host baterium | Klebsiella pneumoniae subsp. pneumoniae strain F5 |
Cargo genes
| Drug resistance gene | catA2, blaCTX-M-65, fosA3, blaKPC-2, blaSHV-12 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |