Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102967 |
| Name | oriT_pAPEC-O2-211C  |
| Organism | Escherichia coli APEC O2-211 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP030793 (1074..1156 [+], 83 nt) |
| oriT length | 83 nt |
| IRs (inverted repeats) | 1..6, 15..20 (GGGGTG..CACCCC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 83 nt
>oriT_pAPEC-O2-211C
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3410 | GenBank | NZ_CP030793 |
| Plasmid name | pAPEC-O2-211C | Incompatibility group | ColpVC |
| Plasmid size | 2096 bp | Coordinate of oriT [Strand] | 1074..1156 [+] |
| Host baterium | Escherichia coli APEC O2-211 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |