Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102951 |
| Name | oriT_pRUM-like  |
| Organism | Enterococcus faecium strain 17i48 ST17 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_KP842560 (17160..17260 [-], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_pRUM-like
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3394 | GenBank | NZ_KP842560 |
| Plasmid name | pRUM-like | Incompatibility group | - |
| Plasmid size | 23269 bp | Coordinate of oriT [Strand] | 17160..17260 [-] |
| Host baterium | Enterococcus faecium strain 17i48 ST17 |
Cargo genes
| Drug resistance gene | ant(6)-Ia, aph(3')-III, cat(pC233), erm(B) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |