Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102947 |
| Name | oriT_p300709_60  |
| Organism | Escherichia coli strain 300709 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP025905 (28388..28473 [-], 86 nt) |
| oriT length | 86 nt |
| IRs (inverted repeats) | 61..68, 73..80 (TTGGTGGT..ACCACCAA) 27..34, 37..44 (GCAAAAAC..GTTTTTGC) 8..13, 21..26 (TGATTT..AAATCA) |
| Location of nic site | 53..54 |
| Conserved sequence flanking the nic site |
TGTGTGGTGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 86 nt
>oriT_p300709_60
AATTACATGATTTAAAACGCAAATCAGCAAAAACTTGTTTTTGCGTAGTGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTT
AATTACATGATTTAAAACGCAAATCAGCAAAAACTTGTTTTTGCGTAGTGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3390 | GenBank | NZ_CP025905 |
| Plasmid name | p300709_60 | Incompatibility group | IncFIB |
| Plasmid size | 60343 bp | Coordinate of oriT [Strand] | 28388..28473 [-] |
| Host baterium | Escherichia coli strain 300709 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | cofA |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |