Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102941
Name   oriT_p13C1065T-4 in_silico
Organism   Escherichia coli strain 13C1065T
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP019263 (1421..1703 [+], 283 nt)
oriT length   283 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 283 nt

>oriT_p13C1065T-4
GGTTATTGCTGCTTTCTGCCGATAACAGTGCAAGTTTTGCGATTTTTTTAAGCGCTTCACAGTTCGTTAGCAAGCTCAGTTTTTTTGATAAAATTCTGGTCAGTTTGTTTAAAAAGTGTTACAGTAAGGCGAATGGTTGAATGGTTAGTTTTAAGACTCAAATCGGCAGTATTAAAATTCCAAAAGTAGCTTTTCATACTTCAAAAAACCAAACTTTAATTTCATGTAGAAGAGTTGTACTATTGTATTGACTCAAGGACAATCCGACATGTCAGAATCAGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3384 GenBank   NZ_CP019263
Plasmid name   p13C1065T-4 Incompatibility group   -
Plasmid size   24727 bp Coordinate of oriT [Strand]   1421..1703 [+]
Host baterium   Escherichia coli strain 13C1065T

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -