Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102924
Name   oriT_p13C1079T-1 in_silico
Organism   Escherichia coli strain 13C1079T
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP019268 (117395..117746 [+], 352 nt)
oriT length   352 nt
IRs (inverted repeats)      255..262, 271..278  (ACCGCTAG..CTAGCGGT)
 192..198, 206..212  (TATAAAA..TTTTATA)
 40..47, 50..57  (GCAAAAAC..GTTTTTGC)
 4..11, 16..23  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 352 nt

>oriT_p13C1079T-1
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCTAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAATTTTAGTGTTTCGAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3367 GenBank   NZ_CP019268
Plasmid name   p13C1079T-1 Incompatibility group   IncFIC
Plasmid size   125272 bp Coordinate of oriT [Strand]   117395..117746 [+]
Host baterium   Escherichia coli strain 13C1079T

Cargo genes


Drug resistance gene   aph(3')-Ia, aph(6)-Id, aph(3'')-Ib, sul2, catA1, tet(B), blaTEM-1B, oqxB, oqxA, sitABCD
Virulence gene   iroN, iroE, iroD, iroC, iroB, iucA, iucB, iucC, iutA
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -