Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102913
Name   oriT_FDAARGOS_90|unnamed3 in_silico
Organism   Shigella sonnei strain FDAARGOS_90
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP014098 (6382..6556 [+], 175 nt)
oriT length   175 nt
IRs (inverted repeats)      101..106, 120..125  (ACAATC..GATTGT)
Location of nic site      65..66
Conserved sequence flanking the
  nic site  
 
 ACTGGCATAA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 175 nt

>oriT_FDAARGOS_90|unnamed3
GTGACTCCGTGCGCGGTGAAAAATCGCATTTTAGCGCGTCACTGGTAGTTGCAAAACTGAACTGGCATAATGCACGGCACATCACGAAGTGCGCACTTATACAATCTCCACTTCATTTCGATTGTGTGCGGTCTGCGACGCTAAAAGAAAACGGCAAAAAGGCATTACGGCAGAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3356 GenBank   NZ_CP014098
Plasmid name   FDAARGOS_90|unnamed3 Incompatibility group   Col156
Plasmid size   8141 bp Coordinate of oriT [Strand]   6382..6556 [+]
Host baterium   Shigella sonnei strain FDAARGOS_90

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -