Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102911 |
| Name | oriT_p1493-3  |
| Organism | Escherichia coli strain CRE1493 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP019074 (32100..32198 [-], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_p1493-3
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3354 | GenBank | NZ_CP019074 |
| Plasmid name | p1493-3 | Incompatibility group | IncFIB |
| Plasmid size | 73992 bp | Coordinate of oriT [Strand] | 32100..32198 [-] |
| Host baterium | Escherichia coli strain CRE1493 |
Cargo genes
| Drug resistance gene | aac(3)-IId, dfrA12, aadA2, oqxA, oqxB, tet(A), blaTEM-1A, sul2, aph(3'')-Ib, aph(6)-Id, floR |
| Virulence gene | - |
| Metal resistance gene | merR, merT |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |