Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102892 |
| Name | oriT1_pSNJS701  |
| Organism | Staphylococcus pasteuri strain JS7 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP017464 ( 89160..89280 [+], 121 nt) |
| oriT length | 121 nt |
| IRs (inverted repeats) | 53..60, 62..69 (TTGGGGAT..ATCCCCAA) 22..28, 36..42 (ATTTTTT..AAAAAAT) 23..29, 34..40 (TTTTTTC..GAAAAAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 121 nt
>oriT1_pSNJS701
AGTGGCTATCAATTAGACACTATTTTTTCGTTAGAAAAAAATCCTAAGGGGCTTGGGGATTATCCCCAACAAGCAGGCGTCGCTACCACGTTAGTGGCTAGCAAAGCCAATACTTGCCAAA
AGTGGCTATCAATTAGACACTATTTTTTCGTTAGAAAAAAATCCTAAGGGGCTTGGGGATTATCCCCAACAAGCAGGCGTCGCTACCACGTTAGTGGCTAGCAAAGCCAATACTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3335 | GenBank | NZ_CP017464 |
| Plasmid name | pSNJS701 | Incompatibility group | - |
| Plasmid size | 115760 bp | Coordinate of oriT [Strand] | 57735..57855 [-]; 89160..89280 [+] |
| Host baterium | Staphylococcus pasteuri strain JS7 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsC, arsB, arsR, mco |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |