Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102883 |
| Name | oriT_FWSEC0290|unnamed4  |
| Organism | Escherichia coli strain FWSEC0290 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RRKF01000112 (5553..5727 [+], 175 nt) |
| oriT length | 175 nt |
| IRs (inverted repeats) | 101..106, 120..125 (ACAATC..GATTGT) 47..52, 58..63 (AGTTTA..TAAACT) 46..51, 54..59 (TAGTTT..AAACTA) |
| Location of nic site | 65..66 |
| Conserved sequence flanking the nic site |
ACTGGCATAA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 175 nt
>oriT_FWSEC0290|unnamed4
GTGACTCCGTGCGCGGTGAAAAATCGCATTTTAGCGCGTCACTGGTAGTTTAAAAACTAAACTGGCATAATGCACGGCACATCACGAAATGCGCACTTATACAATCTCCACTTCGTTTCGATTGTGTGCGGTCTGCGACGCTAAAAGAAAACGGCAAAAAGGCATTACGGCAGAA
GTGACTCCGTGCGCGGTGAAAAATCGCATTTTAGCGCGTCACTGGTAGTTTAAAAACTAAACTGGCATAATGCACGGCACATCACGAAATGCGCACTTATACAATCTCCACTTCGTTTCGATTGTGTGCGGTCTGCGACGCTAAAAGAAAACGGCAAAAAGGCATTACGGCAGAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3326 | GenBank | NZ_RRKF01000112 |
| Plasmid name | FWSEC0290|unnamed4 | Incompatibility group | Col156 |
| Plasmid size | 7441 bp | Coordinate of oriT [Strand] | 5553..5727 [+] |
| Host baterium | Escherichia coli strain FWSEC0290 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |