Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102847 |
| Name | oriT_pCR14_5 |
| Organism | Klebsiella pneumoniae strain CR14 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP015397 (486..535 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pCR14_5
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTAAGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTAAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3290 | GenBank | NZ_CP015397 |
| Plasmid name | pCR14_5 | Incompatibility group | ColRNAI |
| Plasmid size | 9456 bp | Coordinate of oriT [Strand] | 486..535 [-] |
| Host baterium | Klebsiella pneumoniae strain CR14 |
Cargo genes
| Drug resistance gene | aac(6')-Ib |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |