Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102818 |
| Name | oriT_pKp_Goe_208-1  |
| Organism | Klebsiella pneumoniae strain Kp_Goe_33208 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP018448 (11737..11831 [+], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pKp_Goe_208-1
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3261 | GenBank | NZ_CP018448 |
| Plasmid name | pKp_Goe_208-1 | Incompatibility group | IncFIA |
| Plasmid size | 90685 bp | Coordinate of oriT [Strand] | 11737..11831 [+] |
| Host baterium | Klebsiella pneumoniae strain Kp_Goe_33208 |
Cargo genes
| Drug resistance gene | tet(D), mph(A), blaTEM-1A, blaOXA-9, ant(3'')-Ia, cmlA1, aadA2, blaTEM-1C, dfrA14, aac(6')-Ib, sul3, floR, aac(3)-IIa |
| Virulence gene | - |
| Metal resistance gene | merE, merR, merT, merP, merC, merA, merD |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |