Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102815 |
| Name | oriT_pKQPS1  |
| Organism | Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP014697 (37749..37798 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pKQPS1
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3258 | GenBank | NZ_CP014697 |
| Plasmid name | pKQPS1 | Incompatibility group | IncFII |
| Plasmid size | 152001 bp | Coordinate of oriT [Strand] | 37749..37798 [+] |
| Host baterium | Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | mrkA, mrkB, mrkC, mrkF, mrkJ |
| Metal resistance gene | merR, merP, merA, merD, merE, arsH, arsR, arsB, arsC, fecE, fecD, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsA, arsD |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |