Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102811
Name   oriT_pKp_Goe_641-3 in_silico
Organism   Klebsiella pneumoniae strain Kp_Goe_121641
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP018738 (4009..4066 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pKp_Goe_641-3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3254 GenBank   NZ_CP018738
Plasmid name   pKp_Goe_641-3 Incompatibility group   Col440I
Plasmid size   5259 bp Coordinate of oriT [Strand]   4009..4066 [-]
Host baterium   Klebsiella pneumoniae strain Kp_Goe_121641

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -