Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102805 |
| Name | oriT_pKp_Goe_070-1  |
| Organism | Klebsiella pneumoniae strain Kp_Goe_71070 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP018451 (51008..51102 [-], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pKp_Goe_070-1
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3248 | GenBank | NZ_CP018451 |
| Plasmid name | pKp_Goe_070-1 | Incompatibility group | IncR |
| Plasmid size | 90684 bp | Coordinate of oriT [Strand] | 51008..51102 [-] |
| Host baterium | Klebsiella pneumoniae strain Kp_Goe_71070 |
Cargo genes
| Drug resistance gene | blaTEM-1C, aadA2, cmlA1, ant(3'')-Ia, blaOXA-9, blaTEM-1A, mph(A), tet(D), aac(3)-IIa, floR, sul3, aac(6')-Ib, dfrA14 |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merC, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |