Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102766 |
| Name | oriT_pIncR_DHQP1300920  |
| Organism | Klebsiella pneumoniae isolate 11 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP016919 (35510..35604 [+], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pIncR_DHQP1300920
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3209 | GenBank | NZ_CP016919 |
| Plasmid name | pIncR_DHQP1300920 | Incompatibility group | IncFIA |
| Plasmid size | 70830 bp | Coordinate of oriT [Strand] | 35510..35604 [+] |
| Host baterium | Klebsiella pneumoniae isolate 11 |
Cargo genes
| Drug resistance gene | sul2, aph(3'')-Ib, aph(6)-Id, sul1, qacE, cmlA1, ant(3'')-Ia, ere(A), ARR-3, blaSHV-187, aac(3)-IId, blaCTX-M-15, aac(6')-Ib, blaOXA-9, blaTEM-1A |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |