Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102748 |
| Name | oriT_ED23|unamed  |
| Organism | Klebsiella pneumoniae strain ED23 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP016815 (176892..176919 [-], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_ED23|unamed
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3191 | GenBank | NZ_CP016815 |
| Plasmid name | ED23|unamed | Incompatibility group | IncFIB |
| Plasmid size | 212770 bp | Coordinate of oriT [Strand] | 176892..176919 [-] |
| Host baterium | Klebsiella pneumoniae strain ED23 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | iroN, iroD, iroC, iroB, iutA, iucC, iucB, iucA |
| Metal resistance gene | pbrA, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE, terW, terZ, terA, terB, terC, terD, terE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |