Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102746 |
| Name | oriT_p_incR_DHQP1002001  |
| Organism | Klebsiella pneumoniae strain DHQP1002001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP016812 (40691..40748 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_p_incR_DHQP1002001
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3189 | GenBank | NZ_CP016812 |
| Plasmid name | p_incR_DHQP1002001 | Incompatibility group | IncR |
| Plasmid size | 65887 bp | Coordinate of oriT [Strand] | 40691..40748 [-] |
| Host baterium | Klebsiella pneumoniae strain DHQP1002001 |
Cargo genes
| Drug resistance gene | catA1, ere(A), ARR-3, tet(A) |
| Virulence gene | - |
| Metal resistance gene | merC, merP, merT, merR, merD |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |