Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102742 |
Name | oriT_p3K |
Organism | Salmonella enterica subsp. enterica strain SA972816 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP007488 (1659..1733 [-], 75 nt) |
oriT length | 75 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_p3K
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 3185 | GenBank | NZ_CP007488 |
Plasmid name | p3K | Incompatibility group | ColRNAI |
Plasmid size | 3208 bp | Coordinate of oriT [Strand] | 1659..1733 [-] |
Host baterium | Salmonella enterica subsp. enterica strain SA972816 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |