Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 102742
• Name: oriT_p3K
• Organism: Salmonella enterica subsp. enterica strain SA972816
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP007488 (1659..1733 [-], 75 nt)
• oriT length: 75 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 75 nt

>oriT_p3K
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 3185
• GenBank: NZ_CP007488
• Plasmid name: p3K
• Incompatibility group: ColRNAI
• Plasmid size: 3208 bp
• Coordinate of oriT [Strand]: 1659..1733 [-]
• Host baterium: Salmonella enterica subsp. enterica strain SA972816

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -