Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102735
Name   oriT_pAMR588-04-00318_2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00318
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP016566 (992..1074 [+], 83 nt)
oriT length   83 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 83 nt

>oriT_pAMR588-04-00318_2
GGGGTGTCGGGGCGAAGCCCTGACCTGATGGTAATTGTAATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3178 GenBank   NZ_CP016566
Plasmid name   pAMR588-04-00318_2 Incompatibility group   ColpVC
Plasmid size   2246 bp Coordinate of oriT [Strand]   992..1074 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00318

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -