Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102732 |
| Name | oriT_pAMR588-04-00437_2 |
| Organism | Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00437 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP016577 (992..1074 [+], 83 nt) |
| oriT length | 83 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 83 nt
>oriT_pAMR588-04-00437_2
GGGGTGTCGGGGCGAAGCCCTGACCTGATGGTAATTGTAATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
GGGGTGTCGGGGCGAAGCCCTGACCTGATGGTAATTGTAATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3175 | GenBank | NZ_CP016577 |
| Plasmid name | pAMR588-04-00437_2 | Incompatibility group | ColpVC |
| Plasmid size | 2246 bp | Coordinate of oriT [Strand] | 992..1074 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00437 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |