Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102726
Name   oriT_pC2014-5 in_silico
Organism   Staphylococcus equorum strain C2014
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP013719 (2526..2626 [-], 101 nt)
oriT length   101 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 101 nt

>oriT_pC2014-5
TCTTCTGCCGAAACTTTGAATATGAGTGTGCCGAATTTCGTTAAGAAAAAGGCACATGGGAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3169 GenBank   NZ_CP013719
Plasmid name   pC2014-5 Incompatibility group   -
Plasmid size   12006 bp Coordinate of oriT [Strand]   2526..2626 [-]
Host baterium   Staphylococcus equorum strain C2014

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -