Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102721
Name   oriT_2013C-4465|unnamed1 in_silico
Organism   Escherichia coli strain 2013C-4465
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP015242 (63135..63483 [-], 349 nt)
oriT length   349 nt
IRs (inverted repeats)      255..262, 271..278  (ACCGCTAG..CTAGCGGT)
 192..198, 206..212  (TATAAAA..TTTTATA)
 40..47, 50..57  (GCAAAAAC..GTTTTTGC)
 4..11, 16..23  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 349 nt

>oriT_2013C-4465|unnamed1
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGTTTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCACCGACACCGCTTTGTAGGGGTAGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTCTTTATAGGATACCGCTAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAATTTTAGTGTTTCTAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3164 GenBank   NZ_CP015242
Plasmid name   2013C-4465|unnamed1 Incompatibility group   IncFIB
Plasmid size   66029 bp Coordinate of oriT [Strand]   63135..63483 [-]
Host baterium   Escherichia coli strain 2013C-4465

Cargo genes


Drug resistance gene   -
Virulence gene   nleA/espI, exeG, exeE, stcE
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -