Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102716 |
| Name | oriT_FWSEC0432|unnamed9 |
| Organism | Escherichia coli strain FWSEC0432 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RRPB01000156 (15141..15491 [+], 351 nt) |
| oriT length | 351 nt |
| IRs (inverted repeats) | 191..197, 205..211 (TATAAAA..TTTTATA) 196..201, 203..208 (AAAACA..TGTTTT) 111..118, 121..128 (CTGCTTTA..TAAAGCAG) 104..110, 118..124 (TTTAAAT..ATTTAAA) 93..98, 106..111 (GATTTA..TAAATC) 40..47, 50..57 (GCAAAAAC..GTTTTTGC) 4..11, 16..23 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 351 nt
>oriT_FWSEC0432|unnamed9
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACACTACGCAAAAACAAGTTTTTGCTGATTTGCGTTTAATATCATTGAGTTGTATTTGTGGATTTATATTGTTTAAATCTGCTTTATTTAAAGCAGCGTCGTTAACGCCGCTACAGCAACGCGCCGACACCGCTTTGTAGGGGTGTACTGACTATTTTTATAAAAAACATTGTTTTATATTAGGGGGGCTGCTAGCGGCGCGGTGTATTTTTTTATAGGATACCGCCAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAACTCTGGTGTTTCGAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACACTACGCAAAAACAAGTTTTTGCTGATTTGCGTTTAATATCATTGAGTTGTATTTGTGGATTTATATTGTTTAAATCTGCTTTATTTAAAGCAGCGTCGTTAACGCCGCTACAGCAACGCGCCGACACCGCTTTGTAGGGGTGTACTGACTATTTTTATAAAAAACATTGTTTTATATTAGGGGGGCTGCTAGCGGCGCGGTGTATTTTTTTATAGGATACCGCCAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAACTCTGGTGTTTCGAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 14570..21398
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| C9207_RS25230 (C9207_25285) | 10203..10625 | + | 423 | WP_057711496 | conjugation system SOS inhibitor PsiB | - |
| C9207_RS25235 (C9207_25290) | 10622..11341 | + | 720 | WP_000116351 | plasmid SOS inhibition protein A | - |
| C9207_RS25240 (C9207_25295) | 11341..11859 | + | 519 | WP_001178556 | hypothetical protein | - |
| C9207_RS27145 | 11977..12129 | + | 153 | Protein_18 | DUF5431 family protein | - |
| C9207_RS25250 (C9207_25305) | 12074..12196 | + | 123 | WP_223200913 | Hok/Gef family protein | - |
| C9207_RS26560 (C9207_25310) | 12497..12746 | - | 250 | Protein_20 | hypothetical protein | - |
| C9207_RS25270 (C9207_25325) | 13047..13334 | + | 288 | WP_000107526 | hypothetical protein | - |
| C9207_RS25275 (C9207_25330) | 13453..14274 | + | 822 | WP_001234493 | DUF932 domain-containing protein | - |
| C9207_RS25280 (C9207_25335) | 14570..15172 | - | 603 | WP_077539848 | transglycosylase SLT domain-containing protein | virB1 |
| C9207_RS25285 (C9207_25340) | 15492..15875 | + | 384 | WP_001151536 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| C9207_RS25290 (C9207_25345) | 16069..16716 | + | 648 | WP_000332527 | transcriptional regulator TraJ family protein | - |
| C9207_RS25295 (C9207_25350) | 16835..17062 | + | 228 | WP_000589555 | conjugal transfer relaxosome protein TraY | - |
| C9207_RS25300 (C9207_25355) | 17096..17461 | + | 366 | Protein_27 | type IV conjugative transfer system pilin TraA | - |
| C9207_RS25305 (C9207_25360) | 17476..17787 | + | 312 | WP_000012112 | type IV conjugative transfer system protein TraL | traL |
| C9207_RS25310 (C9207_25365) | 17809..18375 | + | 567 | WP_000399772 | type IV conjugative transfer system protein TraE | traE |
| C9207_RS25315 (C9207_25370) | 18362..19090 | + | 729 | WP_001230787 | type-F conjugative transfer system secretin TraK | traK |
| C9207_RS25320 (C9207_25375) | 19090..20517 | + | 1428 | WP_000146631 | F-type conjugal transfer pilus assembly protein TraB | traB |
| C9207_RS25325 (C9207_25380) | 20507..21091 | + | 585 | WP_000002897 | conjugal transfer pilus-stabilizing protein TraP | - |
| C9207_RS25330 (C9207_25385) | 21078..21398 | + | 321 | WP_001057300 | DUF2689 domain-containing protein | virb4 |
| C9207_RS25335 (C9207_25390) | 21436..25050 | + | 3615 | Protein_34 | conjugative transfer relaxase/helicase TraI | - |
| C9207_RS25340 (C9207_25395) | 25070..25816 | + | 747 | WP_000205772 | conjugal transfer pilus acetylase TraX | - |
Host bacterium
| ID | 3159 | GenBank | NZ_RRPB01000156 |
| Plasmid name | FWSEC0432|unnamed9 | Incompatibility group | - |
| Plasmid size | 29337 bp | Coordinate of oriT [Strand] | 15141..15491 [+] |
| Host baterium | Escherichia coli strain FWSEC0432 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |