Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102714
Name   oriT_OLF-00D989 87-1|small in_silico
Organism   Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-00D989 87-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP011945 (1079..1161 [+], 83 nt)
oriT length   83 nt
IRs (inverted repeats)      1..6, 15..20  (GGGGTG..CACCCC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 83 nt

>oriT_OLF-00D989 87-1|small
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3157 GenBank   NZ_CP011945
Plasmid name   OLF-00D989 87-1|small Incompatibility group   ColpVC
Plasmid size   2096 bp Coordinate of oriT [Strand]   1079..1161 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-00D989 87-1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -