Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102713
Name   oriT_pV521 in_silico
Organism   Staphylococcus aureus strain V521 isolate Sequencing
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP013958 (18465..18656 [+], 192 nt)
oriT length   192 nt
IRs (inverted repeats)      135..141, 145..151  (GTCTGGC..GCCAGAC)
 24..29, 41..46  (AAAAAA..TTTTTT)
 4..11, 23..30  (CTTTTTTA..TAAAAAAG)
 16..21, 24..29  (TTTTTT..AAAAAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 192 nt

>oriT_pV521
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3156 GenBank   NZ_CP013958
Plasmid name   pV521 Incompatibility group   -
Plasmid size   28723 bp Coordinate of oriT [Strand]   18465..18656 [+]
Host baterium   Staphylococcus aureus strain V521 isolate Sequencing

Cargo genes


Drug resistance gene   qacA
Virulence gene   -
Metal resistance gene   cadC, merR, merT, merA, merB
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -