Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102710 |
| Name | oriT_FWSEC0432|unnamed6  |
| Organism | Escherichia coli strain FWSEC0432 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RRPB01000153 (1180..1266 [+], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_FWSEC0432|unnamed6
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3153 | GenBank | NZ_RRPB01000153 |
| Plasmid name | FWSEC0432|unnamed6 | Incompatibility group | Col |
| Plasmid size | 1631 bp | Coordinate of oriT [Strand] | 1180..1266 [+] |
| Host baterium | Escherichia coli strain FWSEC0432 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |