Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102710
Name   oriT_FWSEC0432|unnamed6 in_silico
Organism   Escherichia coli strain FWSEC0432
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RRPB01000153 (1180..1266 [+], 87 nt)
oriT length   87 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 87 nt

>oriT_FWSEC0432|unnamed6
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3153 GenBank   NZ_RRPB01000153
Plasmid name   FWSEC0432|unnamed6 Incompatibility group   Col
Plasmid size   1631 bp Coordinate of oriT [Strand]   1180..1266 [+]
Host baterium   Escherichia coli strain FWSEC0432

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -