Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102707
Name   oriT_W25K|unnamed4 in_silico
Organism   Escherichia coli strain W25K
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP091039 (31838..32189 [+], 352 nt)
oriT length   352 nt
IRs (inverted repeats)      192..198, 206..212  (TATAAAA..TTTTATA)
 197..202, 204..209  (AAAACA..TGTTTT)
 104..110, 118..124  (TTTAAAT..ATTTAAA)
 106..111, 113..118  (TAAATC..GATTTA)
 40..47, 50..57  (GCAAAAAC..GTTTTTGC)
 4..11, 16..23  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 352 nt

>oriT_W25K|unnamed4
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGATTTTAATATCATATGCTTATATTCATGAATTTATATTGTTTAAATCAGATTTATTTAAAACAGCGGTGTAGGCGCGGCTATGGCACCGTGTCTGCACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTGTTTTATATTAGGGGTGCTGCTAGCTGCGCGGTGTGTTTTTTTATAGGATACTGCTAGGGGCGCTGCTAGCGGCGCGTTCCTGTTTTCATTGTGAATTTTAGTGTTTCGAAATTAACTTTATTTTATGTTTAAAAAAGGTAATCTCTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


T4SS


T4SS were predicted by using oriTfinder2.

Region 1: 31267..38610

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
L1O49_RS24505 (L1O49_24510) 26406..26807 + 402 Protein_33 DUF1281 domain-containing protein -
L1O49_RS24510 (L1O49_24515) 26809..27174 + 366 Protein_34 hypothetical protein -
L1O49_RS24515 (L1O49_24520) 27229..27663 + 435 WP_000845928 conjugation system SOS inhibitor PsiB -
L1O49_RS24520 (L1O49_24525) 27660..28446 + 787 Protein_36 plasmid SOS inhibition protein A -
L1O49_RS24525 (L1O49_24530) 28596..28748 + 153 Protein_37 FlmC family protein -
L1O49_RS24530 (L1O49_24535) 28696..28815 + 120 WP_228769536 Hok/Gef family protein -
L1O49_RS24535 (L1O49_24540) 29281..29442 - 162 Protein_39 hypothetical protein -
L1O49_RS24540 (L1O49_24545) 29512..29718 + 207 WP_000547959 hypothetical protein -
L1O49_RS24545 (L1O49_24550) 29743..30030 + 288 WP_000107534 hypothetical protein -
L1O49_RS24550 (L1O49_24555) 30150..30971 + 822 WP_001234475 DUF932 domain-containing protein -
L1O49_RS24555 (L1O49_24560) 31267..31914 - 648 WP_000601498 transglycosylase SLT domain-containing protein virB1
L1O49_RS24560 (L1O49_24565) 32190..32573 + 384 WP_001151533 conjugal transfer relaxosome DNA-binding protein TraM -
L1O49_RS24565 (L1O49_24570) 32765..33412 + 648 WP_000332517 conjugal transfer transcriptional regulator TraJ -
L1O49_RS24570 (L1O49_24575) 33548..33763 + 216 WP_000086380 conjugal transfer relaxosome protein TraY -
L1O49_RS24575 (L1O49_24580) 33806..34168 + 363 WP_000340279 type IV conjugative transfer system pilin TraA -
L1O49_RS24580 (L1O49_24585) 34173..34484 + 312 WP_000012106 type IV conjugative transfer system protein TraL traL
L1O49_RS24585 (L1O49_24590) 34506..35072 + 567 WP_000399792 type IV conjugative transfer system protein TraE traE
L1O49_RS24590 (L1O49_24595) 35059..35787 + 729 WP_001230788 type-F conjugative transfer system secretin TraK traK
L1O49_RS24595 (L1O49_24600) 35787..37214 + 1428 WP_000146688 F-type conjugal transfer pilus assembly protein TraB traB
L1O49_RS24600 (L1O49_24605) 37204..37791 + 588 WP_000002772 conjugal transfer pilus-stabilizing protein TraP -
L1O49_RS24605 (L1O49_24610) 37778..38098 + 321 WP_001057283 conjugal transfer protein TrbD -
L1O49_RS24610 (L1O49_24615) 38095..38610 + 516 WP_000724018 type IV conjugative transfer system lipoprotein TraV traV
L1O49_RS24615 (L1O49_24620) 38745..38966 + 222 WP_001278689 conjugal transfer protein TraR -
L1O49_RS24620 (L1O49_24625) 39126..40585 + 1460 Protein_56 TraC family protein -
L1O49_RS24625 (L1O49_24630) 40581..40745 + 165 Protein_57 conjugal transfer protein TraU -
L1O49_RS24630 (L1O49_24635) 40742..41698 + 957 Protein_58 conjugal transfer pilus assembly protein TraU -
L1O49_RS24635 (L1O49_24640) 41703..42179 + 477 Protein_59 conjugal transfer protein TraD -
L1O49_RS24640 (L1O49_24645) 42178..42963 + 786 Protein_60 conjugal transfer protein TraI -
L1O49_RS24645 (L1O49_24650) 42962..43114 - 153 Protein_61 transposase -


Host bacterium


ID   3150 GenBank   NZ_CP091039
Plasmid name   W25K|unnamed4 Incompatibility group   IncFII
Plasmid size   80970 bp Coordinate of oriT [Strand]   31838..32189 [+]
Host baterium   Escherichia coli strain W25K

Cargo genes


Drug resistance gene   -
Virulence gene   faeC, faeD, faeE, faeF, faeG, faeH, faeI, faeJ
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -