Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102702
Name   oriT_INF277|5 in_silico
Organism   Klebsiella pneumoniae strain INF277 isolate INF277
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LR890208 (1550..1607 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_INF277|5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3145 GenBank   NZ_LR890208
Plasmid name   INF277|5 Incompatibility group   Col440I
Plasmid size   1916 bp Coordinate of oriT [Strand]   1550..1607 [-]
Host baterium   Klebsiella pneumoniae strain INF277 isolate INF277

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -