Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 102702
• Name: oriT_INF277|5
• Organism: Klebsiella pneumoniae strain INF277 isolate INF277
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_LR890208 (1550..1607 [-], 58 nt)
• oriT length: 58 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 58 nt

>oriT_INF277|5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 3145
• GenBank: NZ_LR890208
• Plasmid name: INF277|5
• Incompatibility group: Col440I
• Plasmid size: 1916 bp
• Coordinate of oriT [Strand]: 1550..1607 [-]
• Host baterium: Klebsiella pneumoniae strain INF277 isolate INF277

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -