Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102697 |
| Name | oriT1_FWSEC0111|unnamed3  |
| Organism | Escherichia coli strain FWSEC0111 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RRGC01000115 (653..725 [-], 73 nt) |
| oriT length | 73 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 73 nt
>oriT1_FWSEC0111|unnamed3
GTCGGGGCGCAGCCCTGACCAGGCGGGGAATGTCTGAGTGCGCATGCGCGGTCCGACATTCCCACATCCTGTC
GTCGGGGCGCAGCCCTGACCAGGCGGGGAATGTCTGAGTGCGCATGCGCGGTCCGACATTCCCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3140 | GenBank | NZ_RRGC01000115 |
| Plasmid name | FWSEC0111|unnamed3 | Incompatibility group | Col |
| Plasmid size | 3665 bp | Coordinate of oriT [Strand] | 653..725 [-]; 2869..2940 [+] |
| Host baterium | Escherichia coli strain FWSEC0111 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |