Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102693
Name   oriT_FWSEC0121|unnamed4 in_silico
Organism   Escherichia coli strain FWSEC0121
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RRGM01000188 (549..648 [-], 100 nt)
oriT length   100 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 100 nt

>oriT_FWSEC0121|unnamed4
CGGGGTGTCGGGGTGAAGCCCTGACCAGGTGGTAATCGTATCGGCGTGCGTGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3136 GenBank   NZ_RRGM01000188
Plasmid name   FWSEC0121|unnamed4 Incompatibility group   Col
Plasmid size   1627 bp Coordinate of oriT [Strand]   549..648 [-]
Host baterium   Escherichia coli strain FWSEC0121

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -