Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102689 |
| Name | oriT_pNB04-6  |
| Organism | Klebsiella pneumoniae strain NB04 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP091991 (1680..1778 [+], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_pNB04-6
CGGGGTGTCGGGGTGAAGCCCTGACCAGGTGGCATTTGTCTGATTGCGTGTGCGCGGTCCGACAAATGCACATCCTGTCCCGATTTCTGAGGCTTTTTA
CGGGGTGTCGGGGTGAAGCCCTGACCAGGTGGCATTTGTCTGATTGCGTGTGCGCGGTCCGACAAATGCACATCCTGTCCCGATTTCTGAGGCTTTTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3133 | GenBank | NZ_CP091991 |
| Plasmid name | pNB04-6 | Incompatibility group | Col |
| Plasmid size | 1901 bp | Coordinate of oriT [Strand] | 1680..1778 [+] |
| Host baterium | Klebsiella pneumoniae strain NB04 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |