Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102683
Name   oriT1_pKp81_2 in_silico
Organism   Klebsiella pneumoniae strain Kp81
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP025818 (24190..24249 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT1_pKp81_2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3127 GenBank   NZ_CP025818
Plasmid name   pKp81_2 Incompatibility group   Col440I
Plasmid size   30492 bp Coordinate of oriT [Strand]   24190..24249 [-]; 870..927 [+]
Host baterium   Klebsiella pneumoniae strain Kp81

Cargo genes


Drug resistance gene   qnrB19
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -